Miguel Muñoz pasó seis meses internado en el hospital Rawson de San Juan sin que nadie lo identificara ni pidiera por él. Sol Aliverti investigó la trama de esa vida borrada. Esta crónica resultó ganadora del concurso Crónicas Interiores 2015, organizado por por la Gaceta Deodoro de la Secretaría de Extensión Universitaria de la Universidad Nacional de Córdoba (UNC), por Anfibia (Unsam) y por la Editorial de la Universidad Nacional de La Plata (Edulp), con el apoyo del Sindicato Regional de Luz y Fuerza de Córdoba y de la editorial Recovecos.



Lo primero que supe de él fue una foto en la que aparenta mirar de frente a la cámara pero en realidad no. La mirada se fija en un punto inaccesible fuera del cuadro: los ojos negros, una camiseta blanca, el pelo ondulado, el hueco en la cabeza. Parece distraído en una idea que solo él comprende, como si se tratara del momento anterior al descubrimiento de algo. Alguien le habrá dicho que se quede quieto. No sonríe, no tiene por qué hacerlo. Los diarios locales supieron del caso y desplegaron algunos títulos con pereza, con una atención que se parece al hallazgo de una rareza de circo: “El hombre que perdió la memoria”, “El hombre que no sabe quién es”. El 19 de febrero de 2015, por la madrugada, en la esquina de Pueyrredón y Libertador de la ciudad de San Juan, un hombre de unos 50 años fue encontrado con un golpe en la cabeza. Su cuerpo quedó en la vereda, en esa intersección ruidosa de una calle de cuatro esquinas, en la zona oeste. La ambulancia lo llevó al hospital Rawson y ahí hicieron lo que había que hacerse: se dieron cuenta de que había que descomprimir y descomprimieron. Fue tarde para algunas cosas: aquel hombre pudo salvarse, pero parte de su cerebro fue perdida y con ella todo lo que la bolsa de la memoria podía retener. Cuando el hombre despertó, todo lo que lo hacía él mismo había desaparecido: apenas balbuceaba, no sabía su nombre, no podía tragar, ni masticar, ni mover un brazo, ni sostenerse sobre sus pies. Esa culminación de una serie de causas y efectos de las que no se tiene control aparente había convertido el simulacro de esa vida en un vacío blanco en el mundo. Ya no había hacia dónde ir, ni hacia donde volver. En el hospital siguieron los procedimientos habituales. Luego de hacerse la denuncia, se supo que aquel hombre había sido golpeado por alguna de las tres personas con las que había estado esa noche, cerca de una verdulería. No tenía documentos y las huellas no mostraron datos: se solicitaron antecedentes en las comisarías de San Juan, San Luis y Mendoza y del hombre no se sabía nada. Para la justicia, al menos, aquel aparecido era un hombre bueno. Después de estar 26 días en terapia intensiva, su presencia empezó a intranquilizar. Pasaron seis meses y de aquel aparecido nada se sabía. Lo llamaron Darío porque era un nombre que dicen que repetía. Le agregaron Nuñez, porque así les pareció que podía quedar bien. Además era capaz de algunas cosas: decir que sí, decir que no, decir frío, decir caliente.

 

***

Puede que no importe decirlo, pero hay un punto de partida: todo misterio habilita cierta intromisión. Si “ser humano” es una incógnita, si a la pregunta de qué somos le agregamos la amnesia, entonces aquel aparecido vive su propio misterio duplicado. La pregunta no sólo es quién era ese hombre, por qué estaba ahí, por qué nadie lo quería, por qué nadie lo odiaba, cómo se construye una vida que no puede ser recordada y cómo se le asigna sentido en una sola dirección. También podía tratarse de un miedo reflejado: cómo podía resultar posible caerse del mundo y que nadie lo note.

***

A la ciudad de San Juan le dicen la ciudad del sol. Aunque parezca un cliché turístico, ese dato no parece condicionar la realidad: es cierto que todo parece más luminoso. Puede que el dato sea una confirmación de algo que parece obvio: todo cabe bajo el sol, y no hay edificios lo suficientemente altos como para oscurecer su influencia. No más de tres pisos por los temblores que se registran en la zona. También dicen que es difícil perderse: la ciudad es una cuadrícula y todas las calles se llaman igual desde que empiezan hasta que terminan. Sólo hay que saber hacia qué punto cardinal dirigirse y moverse en el espacio como lo haría un buen marinero: este, oeste, norte, sur.

 

Después de seis meses sin saber quién era, y sin que nadie reclamara, el hospital Rawson pidió que se lo admitiera en la Casa de la Bondad, un hospice de la fundación Manos Abiertas fundada hace tres años en San Juan. Un hospice es un lugar donde la gente va a morir. Pero no es que la gente no se pueda morir en cualquier lado, es que allí todo está preparado para morir bien. El lugar tiene apenas cuatro camas y un aspecto gentil y pacífico: las paredes pintadas de un amarillo claro, un sillón verde al que le pusieron una manta para que no se note y un patio grande y verde que antes fue terreno fiscal. Días atrás había llamado el intendente de un pueblo de San Luis llamado Unión diciendo que tenía el dato de que ese hombre no se llamaba Darío, que se llamaba Miguel.

 

—Estamos hablando de una posibilidad, no hay nada que determine con exactitud. No podemos decir que es Ramón Miguel Muñoz. Todo son llamadas telefónicas. Parece que tenia conductas nómades, que andaba de provincia en provincia, y donde iba hacía changas.

 

La que habla detrás del escritorio en una suficiencia espiritual que la habilita a no desmoronarse ante la muerte es Mirtha Cuadros, directora de la Casa. A su lado, sentada está Mirta Gari, vice directora. Las dos perdieron la cuenta de la cantidad de personas que vieron morir ahí. Nadie les paga. Ayudar a morir a otros parece bastarles. Todos mueren. En la punta de la cama hay un cartel con letras amarillas que dice Miguel. Su presencia en el hospice no es habitual. Miguel no va a morir. No pronto, no es lo que parece.

 

—Es precioso como se comunica, vos vas pasando y te dice: ¡hola, hola hola! Te repite frases, ha dicho Quiroga, por ejemplo. Una chica de cocina vino y dijo: che, dijo un montón de cosas, así que ahora hemos instrumentado un cuadernito para que no se nos pase.

 

Los 110 voluntarios que colaboran en la casa de la bondad se preparan para estar atentos a los deseos del que está por morir. ¿Y como saben que es lo que desea alguien que no sabe quién es? La duda parece existencial pero es algo más simple: todos necesitan que los agarren de la mano y les otorguen el derecho a morir con algo de ternura. Ese día, por la mañana, el hombre fue a parar de nuevo al hospital Rawson. Tenían que hacerle un control médico porque había amanecido con fiebre. Antes, por las dudas entienda, por las dudas extrañe, le explicaron que iba irse, pero que luego iba a volver. Las cocineras dicen que ha mejorado: cuando le llevan un plato y le preguntan si le gusta el hombre dice: sisisisisi, mucho mucho, todo todotodo.

 

El intendente de Unión, Rodolfo Becerra, confía en que aquel hombre sea Miguel Muñoz y del otro lado del teléfono me dice que pude darme el teléfono de Miguel Pérez, un primo del pueblo que aparentemente está al tanto de todo. Miguel Pérez confirma: es mi primo, ha sufrido tanto, pero desde los 28 que él no está acá. Le paso el número de mi tía, la Ramona Fernández, ella le puede contar más porque lo crió cuando él era chiquito.

 

La cadena de posibles identidades se extiende: un hombre comienza a ser la multitud de voces que lo murmuran, que dicen que lo han conocido.

***

El hombre sin memoria había tenido algo de impacto en los medios locales y nacionales. No hubo muchas historias así: hacía poco, otro aparecido había sido recibido como un héroe luego de sobrevivir en la Cordillera de los Andes comiendo ratas. Decía que no recordaba su nombre. Lo había encontrado un baqueano y llegó a San Juan moribundo. El gobernador, José Luis Gioja, lo recibió levantándolo en sus brazos en un gesto de admiración compasiva un tanto exagerada, como si hubieran estado actuando una versión masculina de La Piedad. Sobrevivir tiene un encanto que no lo da nada. Gioja lo sabía después de no morir en el accidente de helicóptero que lo tuvo en el Rawson durante meses. Después se supo que aquel hombre era buscado por la policía chilena por estar acusado de violación a menores, cargos que no se comprobaron luego y del hombre, una vez dado de alta, no se supo más nada ni nadie preguntó por él.

 

El doctor Norberto Navalta es el jefe del Área Clínica Médica del Rawson. En ese hospital trabaja hace 39 años viendo casos como éste, aunque no exactamente como el de Miguel. Eso sí que no pasó nunca. Hay NN, ingresan todo el tiempo, pero no permanecen.

 

—Acá dice que ingresó hoy. Señala una planilla en la que figuran ingresos y egresos. ¿Ve? ahí dice, ingresó Mario… parece que ya le cambiaron el nombre de nuevo.

 

—Si por razones de operatividad la casa de la bondad lo desocupa, tiene que volver acá, hasta que alguien lo retire. No ha avanzado nada a nivel intelectual, de orientación en el tiempo y el espacio. Hay ciertas cosas: uno no sabe si hay delirio o fijaciones de algunas imágenes. Son ideas aisladas, el resto del día está autista, sin hablar absolutamente nada.

***

El hombre levanta la cabeza y clava la mirada en la puerta ni bien atravesamos la habitación. Otro hombre, desde la cama contigua, toma el mástil que sostiene el suero, se pone de costado y se queda atento sin saludar. Miguel frunce el ceño, sus gestos parecen indicar que existe una voluntad por saber quien está ahí, quien entra, quien lo mira. El miedo de no reconocer y no ser reconocido recubre todo de una ansiedad que parece lejos de cualquier cosa humana. Me apuro a decir mi nombre, a contarle que hago ahí. Recuerdo lo que había dicho Mirtha y le cuento a Miguel que al otro día voy a ver a su tía Ramona. ¿Te acordás de ella?, pregunto.

Miguel empieza a repetir palabras con una densidad rítmica sin sentido:

 

—yeguayeguayeguayeguaaguaaguaaguaaguaaguagau, gallina gallinagallinagallinasisisisisisisis, quedatequedate queda.

Dejo de insistir en hablar con él y nos quedamos en silencio un rato. Cuando nos vamos, Miguel reacciona con la misma extrañeza y se queda balbuceando algo que no alcanzo a escuchar.

***

La verdulería es un montaje de chapa y palos, piso de tierra con cajas de frutas y verduras que dan a la calle. Un hombre pesa unos tomates en una balanza colgante de hierro y anota en un papel. Pregunta qué necesito. El hombre mira con desconfianza y se apoya en la balanza después de escucharme.

 

—Entonces tenés que hablar con él—dice, y señala a un hombre en una silla de plástico, de brazos cruzados con un sombrero.

Julio Gallo es el nombre del dueño de esa verdulería. Miguel, como se hacía llamar, no decía mucho de su vida.

 

—Era un tipazo— dice, sin descruzar los brazos.

 

 Esa es la primera definición que oigo de alguien que lo conoció antes de que fuera lo que es.

 

—Era un tipazo, repite.

 

Que tenía campos, caballos, y que dejó todo.

 

—¿Eso decía?

 

—Si, lástima que le gustaba chupar.

 

Julio habla con una desafección curtida que lo hace parecer inmune a cualquier sentimiento. Miguel había venido hacía seis meses, y ahí se había quedado sin mediar demasiadas explicaciones. Julio necesitaba ayuda y él necesitaba lugar donde dormir. Sabía de sus padres muertos, sabía que de su familia no hablaba ni bien ni mal, sabía que había tenido todo lo que se espera que una vida pudiera tener—hasta una hija — y que luego se fue. Julio hace un gesto de negación.

 

—Y esos hijos de puta le pegaron un palo en la cabeza.

 

Esa noche dicen que estaba con tres personas más: una mujer y dos hombres. En un momento se desconocieron. Uno le pegó con un palo y así dio comienzo a esta historia. Quise preguntarle a Julio por qué no había ido a verlo, pero temí que no quisiera contarme más nada. El temor no poder confrontar lo que el otro no hace por ignorancia o debilidad, terminó siendo un eco fragmentado de esa realidad que no terminaba de construirse. El otro hombre, cerca de la balanza, siguió la conversación. Pero en un momento Julio se quedó mirando hacia adelante y fue dejando espacio entre respuesta y respuesta. Pregunté cómo llegar al centro y me dijo – como todos ahí- que si seguía derecho, llegaba seguro.

***

La casa de Ramona Fernández queda al final de una calle que sube y que se topa con un pedazo de sierra en Juan Koslay, una ciudad pequeña a diez kilómetros de San Luis. Es una mujer de unos 70 años que todavía conserva ese andamiaje anímico inocente, algo que con todo prejuicio puede decirse que es una característica de la gente que no ha crecido en una ciudad. Cuando abre la puerta me abraza como si fuera alguien a la que ha estado esperando para darle buenas noticias. El misterio, antes de que podamos hablar, es saber si aquel hombre es el mismo hombre del que hablamos.

 

Me pregunta cómo está Miguel, parece preocupada porque ella dice que no lo había reconocido. Se pregunta cómo va a hacer con el dinero del viaje para visitarlo, quiere hablar con sus hermanos.

Concurso_cronicasint_Losada_1

—Antonio, traeme la foto— le ordena al nieto que va a hasta el living y trae una portarretratos. En la imagen un niño de unos dos años está sentado sobre las piernas de su padre. El niño parece mirar a la cámara pero no, mira al costado, a un punto en blanco que no sale en el cuadro. Tiene puesto un sombrero blanco, no sonríe, su padre tampoco, los dos están congelados en un tiempo ideal en el que el futuro es una promesa floreciente. Ramona saca un papel detrás del marco. Dice: Ramón Miguel Muñoz, nacido el 13 de junio de 1967 en Unión, San Luis. Me alivia, ahora sí saber que podemos empezar a decir quién es – quien fue- ese hombre.

***

Ramón Miguel Muñoz es hijo de María Fernández y de Ramón Muñoz. María era hermana de Ramona y murió cuando tenía 21 y Miguel apenas un año. Estaba embarazada de un varón de seis meses. Dicen que fue un paro.

 

—Bueno, dicen. En esa época te morías y te enterraban sin preguntar mucho.

 

Ramón tenía campo, algo así como tres mil hectáreas. Era un hombre grande. Con María se llevaban 29 años, diferencia que no pareció importarle a nadie de la familia. Se conocieron en un campo cerca de Unión, en una fiesta del pueblo. María se murió, contradiciendo cualquier pronóstico.

 

—Y ahí quedé yo para cuidarlo. ¿Sabe lo que sufrió esa criatura? Noche enteras amanecido llorando porque pedía por la madre. El padre lo llevaba a una escuela, a otra escuela, porque eso estaba en la cabeza del padre. Pensaba yo: “Déjelo que viva tranquilo pobrecito”. Lo apartaron de mí y estaba conmigo el chico. Y lo sacaron, y eso fue otro sufrimiento más porque ya estaba atado a mí.

 

De los 12 hermanos, quedaron apenas cinco. Mientras Ramona ceba mates, su hija, Natalia prepara milanesas ante la mirada alerta de un gato blanco que se pone cerca de sus pies. La convivencia parece pacífica: también hay un perro y en el suelo, muy cerca de él, un loro.

 

—De chico era malo, nervioso. Lo hacíamos renegar y se ponía colorado como un tomate. Por eso le decían tomate: porque era blanco – blanco y colorado de cara. Ahora lo desconozco, pero esos rulos grandes siempre los tuvo. La madre tenía rulos. Pero lo desconozco. Me da una idea, se ve que es lo que está internado. Yo no sé que decidir, si lo van a dejar ahí o que va a pasar.

 

Se enteraron de la aparición de Miguel hace quince días cuando apareció por televisión. La última vez que lo habían visto fue en 2004. La abuela de Miguel había muerto y lo buscaban porque querían hacer la sucesión de la casa en Unión. Le habían dicho que Miguel estaba tirado y borracho en la terminal de Alvear, Mendoza. La última vez antes de eso fue cuando tenía 18 años y su padre había muerto de cáncer. Miguel comenzó a vender el campo, todo lo que pudo. Y de ahí no se supo más.

 

—Nos fuimos con mi cuñada y nos quedamos todo el día porque queríamos verlo. Cuando quisimos ver, estaba parado uno comprando cigarrillos en un quisco. Me decía mi cuñada: vaya a saber si es él, y yo sabía que era él. Cuando voy, lo toco por el hombro y se me queda mirando así —Ramona abre un poco los ojos— y me dice “¡Uy tía!” Y me abrazó, me tuvo un rato abrazada. Y ya le contamos de la mami, y él nos dijo que no tenía interés en la casa, que él no iba a vivir en Unión. Era un chico que no tenía interés para nada. A nosotros nos habían dicho que estaba borracho, que andaba tirado. No, nada que ver, estaba con unos camiones que eran del suegro y que tenía una nena que no sé si se llamaba Romina o Joana.

 

Se fueron a tomar un café y Ramona pudo contarle todo. Él le dijo que estaba bien, que no necesitaba nada, que no tenía teléfonos porque no le hacía falta. Un hombre se acercó a la mesa y le dijo a Miguel que ya salían. Miguel respondió que se vayan sin él, que había llegado una tía muy querida que no veía hacía mucho. Ramona no sabe la cantidad de cosas que hablaron, lo que se acuerda de esa última vez es que hablaron sentados en esa mesa de la terminal hasta que el colectivo de las seis vino, y ellas se fueron.

 

—De ahí no supimos más nada de él. Yo decía: donde andará.

 

—Le dije que iba a venir a verte y comenzó a nombrar animales— conté

 

—¿En serio? Escuchá lo que está contando, Natalia.

 

Natalia deja de hacerlas milanesas y presta atención. Mientras hablamos, el resto de la familia (nieto, nieta, abuelo, tío) se sientan para escuchar la conversación. La vida de Miguel fue un misterio aun para ellos que conservan algunos recuerdos y solo eso.

 

—El que va a saber más de él es Quiroga, dice Natalia. El amigo que lo reconoció. Yo te puedo conseguir el número de teléfono pero te tenés que ir ya, porque hay un solo colectivo que va y vuelve en el día para Buena Esperanza.

 

—A mí me gustaría ir a verlo, quién sabe si ve a algún familiar si recuerda algo. Pero yo no lo puedo tener, dice Ramona.

 

Al rato llegan todos a comer. Ramona me dice que cualquier cosa que se acuerde, o si llega a ir a verlo, me avisa. La realidad son apenas detalles que se retienen a lo largo de la vida. Algunas gallinas, llantos, el campo, una despedida.

***

Después, doscientos kilómetros de una ruta larga en la que el paisaje cambia, ondula, desaparece. Buena Esperanza es un pueblo paralelo a las vías del tren. Se anuncia con una arcada blanca, su nombre acompañado con la leyenda que aclara que es “La Capital de la tradición” y una hilera de árboles pintados de blanco que continúan hasta que se topan con el campo. Cualquier cosa que no sea pueblo es llanura. Había llamado a Ramón Quiroga antes de salir. Le dije que quería hablar con él acerca de su amigo. Venga que yo le cuento todo, contestó por teléfono. Me indicó cómo llegar a su taller mecánico. Había que entrar por la calle principal donde algunos adolescentes juegan a treparse a una moto que no arranca y largarse calle abajo. Todo cabe en esa calle recta: la plaza, los quioscos, la iglesia, el colegio. Ramón Quiroga sale del taller de chapa y me reconoce sin que le diga nada. Tiene un overol azul, las manos con grasa, me indica que lo espere. Hablamos bajo la sombra de un paraíso. La última vez que vio a Miguel Muñoz fue a mediados de 2008. Él estaba agachado y un hombre alto entro saludando como si nada.

 

—Esperate que no me estoy dando cuenta quien sos— dijo Ramón.

 

—Ey Ramito, no te vas a dar cuenta quien soy, soy yo, el Tomate.

 

Ramón, Ramito, se dio cuenta que ese hombre alto, morocho, de rulos, era el mismo Miguel de Unión, el que vivía dos cuadras de su casa de la infancia, al que no veía desde entonces. A partir de ahí se quedó ayudando en algo que desconocía, pero que hacía para ganarse la vida. Ramón le dejó lugar en el taller.

 

—Lo único que me preocupaba era que tomaba mucho. Le decían vaca puta, porque se pasaba dos Toros por día. A Ramón le da vergüenza decirlo y se ríe.

 

—No te preocupes Ramito, yo no te voy a traer problemas, yo me voy pronto.

 

—No es por eso que te lo digo, es porque te quiero mucho.

 

 Miguel lo había encontrado porque supo por una hermana que su amigo se había mudado al pueblo hacía unos años. El pueblo no tiene más de tres mil habitantes, lo que hace factible encontrarse con todos, más con el mecánico. A Ramón le interesa saber qué hago ahí, que voy a hacer con la historia de Miguel y que piensan mis padres acerca de esto. A todo respondo que no sé, aunque intento dar alguna explicación que nos satisfaga: quiero saber quien es un hombre, quiero saber quien fue antes de ser eso que balbucea en una cama.

 

Ramón tiene dos hijas y una mujer recuperándose de un ACV.

 

—Este año me saqué todos los números, dice.

 

Aunque vivía la apacible vida de los pueblos, con lo que puede ocurrir en la vida de cualquiera, después de Miguel todo cambió. Un día estaba viendo televisión y la cara de su amigo apareció en primer plano: el hombre sin memoria.

 

—Ese es el Miguel, le dijo a su mujer —hace una pausa—Me dio tanta impotencia, tanta impotencia.

 

A partir de ahí llamó al hospital y se quedó en contacto con la trabajadora social, Noelia Cano, quien fue la que se ocupó del caso desde que Miguel entró al hospital. Sólo conocían una tía, por parte del padre: una mujer ciega de 84 años que vivía en Unión. De ahí había venido su vocación por tomar: todos en la familia tomaban. El padre, la madre, las tías. Se sentaban por las tardes y tomaban. No porque la vida les fuera trabajosa, sino por todo lo contrario.

 

Después que se supo la noticia Miguel se vio en la obligación de abrir un perfil en facebook y empezar a ser el portavoz de la historia. Me muestra en una tablet que apenas maneja las notas periodísticas que salieron en los diarios y un informe en la televisión donde habla el doctor Navalta. Ramón quiere que me fije especialmente en el momento en el que médico se emociona por el caso de Miguel.

 

—En el pueblo ya me dicen el Negro Oro, por eso de “gente que busca gente”.

 

Habían sido sólo seis meses los que Miguel había estado en el taller. Una vez por semana, se iba solo a donde estaba el teléfono y llamaba a su hija. Ramón lo dejaba solo, sabía que se emocionaba, que era siempre a la misma hora pero que no hablaba mucho de ella, solo le decía que tenía la edad de la mayor, y que quería ir a verla, y eso era todo.

 

—A él le encantaban las alpargatas blancas. Las zapatillas no. Yo le compré un par de borcegos y los usó un tiempo y después andaba con alpargatas. Me daba la ropa y se lavaba mi señora. Sino él se lavaba la ropa en el taller. Y yo lo cagaba a pedo: ya te has lavado la ropa vos y te la has puesto arrugada, dejate de joder. En mi casa se plancha todo, hasta las medias.

 

También le gustaban los guisos, los pasteles y las milanesas.

 

Eso días habían sido cálidos. Ramón lo había llevado a hacer un curso de juntas. Y qué se yo de juntas, le había dicho Miguel. Pudo convencerlo porque iban dar de comer gratis y además le iban a dar un certificado. Ramón entra al taller y vuelve con un papel doblado que despliega como si fuera la constancia de una vida que ha tenido significado: Certifico que Ramón Miguel Muñoz ha realizado el curso de nuevos materiales de alta tecnología para juntas, a cargo de Carmelo Caparelli. Está fechada el 31 de octubre de 2008.

 

—¿Ve? Nos matamos de risa ese día.

 

Casi llegando a fin de año, Miguel se fue. Ramón se acuerda porque hacía calor. No mucho tiempo después supo que anduvo cerca juntando leña y que le había pedido a un conocido del pueblo que le mandara saludos a Ramito Quiroga, que en Buena Esperanza lo conocían todos. Una vez le vinieron con el rumor de que lo habían matado cerca de Alvear.

 

—Noelia Cano, la asistente social, le ha dicho: ¿Sabes con quien estuve hablando y me pregunta por vos? Ramón Quiroga. ¿Ramo Quiroga?, dice que dijo. Como que me conoce.

 

El doctor Navalta coincide en que si alguien le dice quien es, si alguien pone cosas en su memoria, puede haber un nuevo punto de partida, aunque fragmentado, difuso. Algo así me había dicho —no es que me haya dicho, es que yo creí que me decía—Carlos, un hombre con el que viajé desde San Juan a San Luis. Me preguntó que hacía ahí. Inventé una excusa: contar la historia de Miguel —una historia que ni yo misma sabía— podía llevarme las cinco horas que nos separaban de un destino a otro. En cambio, pregunté por él. Soy de acá, hace 30 años que no venía, me dijo. Carlos sacó la cámara de fotos y me mostró los diques, montañas, y amigos que pudo ver en esos quince días. Era un viaje que teníamos pensado con mi mujer, contó. Yo quería que ella conociera el lugar donde nací. Pero resulta que un mes antes de concretar, a ella le diagnosticaron leucemia y murió a los quince días. Carlos suspiró. Después fue un lío con la cantidad de papeleo.

 

—Una muerte es peor que un nacimiento. Porque con la muerte vos tenés que cerrar todas las cosas que el muerto dejó abierto.

Dicho esto, se tapó con una manta, sacó unas galletas de una bolsa y ajeno a toda imposibilidad, se puso a mirar por la ventanilla, vaya a saber qué cosa.


¿Te gustó la nota?

AUTORES

LECTURAS RELACIONADAS